Raw Data Processing

Last updated on 2026-09-08 | Edit this page

Overview

Questions

  • How do we organize scRNA-seq data files on an HPC cluster?
  • How do we align 10x Chromium FASTQ files with Cell Ranger?
  • How do we run STARsolo as an open-source alternative?
  • How do the outputs from Cell Ranger and STARsolo compare?

Objectives

  • Set up a working directory and verify FASTQ and reference files on the cluster
  • Write and submit a SLURM job script for Cell Ranger count
  • Write and submit a SLURM job script for STARsolo
  • Interpret Cell Ranger’s web_summary.html and key QC metrics
  • Compare the filtered count matrices produced by both tools
Prerequisite

Prerequisites

This episode requires an active account on Purdue’s Negishi cluster and familiarity with basic Linux commands (cd, ls, mkdir, cat). You should be comfortable submitting SLURM jobs with sbatch and monitoring them with squeue. This episode requires shell access to the Negishi cluster via SSH. See the SSH Setup section for connection instructions.

Callout

Cell Ranger Licensing

Cell Ranger is proprietary software from 10x Genomics. It is free to download and use, but it requires acceptance of the 10x Genomics End User License Agreement. STARsolo is fully open source (MIT license) and produces equivalent results. If you cannot use Cell Ranger due to licensing constraints, STARsolo is an excellent alternative. This workshop covers both tools so you can choose whichever is appropriate for your situation.

Data Organization


Before running any alignment, we need a clean directory structure. All workshop files live under ${RCAC_SCRATCH}/scrna_workshop/. Let’s create the directory layout and copy the data.

BASH

mkdir -p ${RCAC_SCRATCH}/scrna_workshop/{fastq,reference,cellranger_output,starsolo_output}

This creates the following structure:

${RCAC_SCRATCH}/scrna_workshop/
├── fastq/                  # Raw FASTQ files
├── reference/              # Reference genome and index
├── cellranger_output/      # Cell Ranger results
└── starsolo_output/        # STARsolo results

Now copy the pre-staged workshop data from the shared depot:

BASH

rsync -avP /depot/workshop/data/scrna_workshop/ ${RCAC_SCRATCH}/scrna_workshop/

Extract the 10x barcode whitelist from the Cell Ranger container (needed for STARsolo):

BASH

module load biocontainers
singularity exec ${BIOC_IMAGE_DIR}/cumulusprod_cellranger:10.0.0.sif \
    zcat /software/cellranger-10.0.0/lib/python/cellranger/barcodes/3M-february-2018_TRU.txt.gz \
    > ${RCAC_SCRATCH}/scrna_workshop/reference/3M-february-2018.txt

Verify that the FASTQ files are present:

BASH

ls -1 ${RCAC_SCRATCH}/scrna_workshop/fastq/

OUTPUT

pbmc_10k_v3_S1_L001_I1_001.fastq.gz
pbmc_10k_v3_S1_L001_R1_001.fastq.gz
pbmc_10k_v3_S1_L001_R2_001.fastq.gz
pbmc_10k_v3_S1_L002_I1_001.fastq.gz
pbmc_10k_v3_S1_L002_R1_001.fastq.gz
pbmc_10k_v3_S1_L002_R2_001.fastq.gz

Verify that the reference genome is present:

BASH

ls ${RCAC_SCRATCH}/scrna_workshop/reference/

OUTPUT

3M-february-2018.txt  refdata-gex-GRCh38-2024-A

Understanding the FASTQ file names

The file names follow the 10x Genomics naming convention:

pbmc_10k_v3_S1_L001_R1_001.fastq.gz
│            │  │    │   └── File number (always 001 for single-file lanes)
│            │  │    └────── Read type: R1 or R2
│            │  └─────────── Lane number: L001 or L002
│            └────────────── Sample index: S1
└─────────────────────────── Sample name

This dataset was sequenced across two lanes (L001, L002), producing four files total: two lanes times two reads per lane.

What is in each read?

Read 1 (R1) contains the cell barcode and UMI. It is 28 bp long: the first 16 bases are the cell barcode (which cell this read came from) and the next 12 bases are the UMI (which original mRNA molecule this read represents). Read 1 does not contain any transcript sequence.

Read 2 (R2) contains the cDNA insert. This is the actual transcript fragment that gets mapped to the reference genome to determine which gene the mRNA came from. It is typically 90–150 bp long.

Let’s inspect the first few reads from each file to see this in practice:

BASH

cd ${RCAC_SCRATCH}/scrna_workshop/fastq
zcat pbmc_10k_v3_S1_L001_R1_001.fastq.gz | head -8

You will see two FASTQ records. Each record has four lines: a header line starting with @, the sequence, a + separator, and quality scores. Notice that every R1 sequence is exactly 28 bp – that is the 16 bp cell barcode followed by the 12 bp UMI.

OUTPUT

@A00228:279:HFWFVDMXX:1:1101:3260:1000 1:N:0:NCAAGATG
NACCAACAGTCGAATAGTGTCATCTGCT
+
#FFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00228:279:HFWFVDMXX:1:1101:3821:1000 1:N:0:NCAAGATG
NTGTCTTAGCCTAGGACGGCCTCCGCCA
+
#FFFFFFFFFFFFFFFFFFFFFFFFFFF

BASH

zcat pbmc_10k_v3_S1_L001_R2_001.fastq.gz | head -8

R2 reads are longer (91 bp in this dataset) and contain transcript sequence that will be mapped to the genome.

OUTPUT

@A00228:279:HFWFVDMXX:1:1101:3260:1000 2:N:0:NCAAGATG
NTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAA
+
#FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00228:279:HFWFVDMXX:1:1101:3821:1000 2:N:0:NCAAGATG
NTTCTATTGGAAACCCGGTCTTTACAAAAAAATACAAAAATCAGCTGGGCGTTGGCCGCGCGTGGTGGCTCACACCTGTAATCTCAGCACT
+
#FFFFFFFFFFFFFFFFFFFFFF:,FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF:FFFFFF:FFF:F:FFFFFFFFFFFFFFF

The reference genome

The reference genome is a 10x Genomics pre-built package based on the human GRCh38 assembly. This package contains everything Cell Ranger needs to align reads:

BASH

ls ${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A/

OUTPUT

fasta/     genes/     reference.json     star/

The key components are:

  • fasta/genome.fa – the genome sequence (FASTA)
  • genes/genes.gtf – the gene annotation (GTF)
  • star/ – a pre-built STAR genome index (used internally by Cell Ranger)
  • reference.json – metadata about the reference build

Both Cell Ranger and STARsolo use STAR for alignment under the hood. Cell Ranger ships its own bundled STAR binary and uses the index inside this reference package. For STARsolo, we can either build our own STAR index or reuse the one inside this package.

Processing with Cell Ranger


Cell Ranger is the official analysis pipeline from 10x Genomics. The cellranger count command takes FASTQ files and a reference genome as input and produces a filtered UMI count matrix as output. We will run it as a SLURM batch job on Negishi.

Create the job script:

BASH

cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/run_cellranger.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=cellranger
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=cellranger_%j.out
#SBATCH --error=cellranger_%j.err

# Load modules
ml --force purge
ml biocontainers
ml cellranger

# Move to the output directory
cd ${RCAC_SCRATCH}/scrna_workshop/cellranger_output

# Run Cell Ranger count
cellranger count \
    --id=pbmc10k \
    --transcriptome=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A \
    --fastqs=${RCAC_SCRATCH}/scrna_workshop/fastq \
    --create-bam true \
    --sample=pbmc_10k_v3 \
    --localcores=${SLURM_CPUS_ON_NODE} \
    --localmem=100
EOF

Submit the job and monitor its progress:

BASH

cd ${RCAC_SCRATCH}/scrna_workshop
sbatch run_cellranger.sh
squeue -u ${USER} # or squeue --me

The job typically takes 30–60 minutes on 16 cores, depending on cluster load.

Cell Ranger count parameters

Parameter Value Description
--id pbmc10k A unique run ID. Cell Ranger creates an output directory with this name.
--transcriptome .../refdata-gex-GRCh38-2024-A Path to the 10x-compatible reference genome package containing the FASTA, GTF, and STAR index.
--fastqs .../fastq Directory containing the FASTQ files. Cell Ranger auto-detects files matching the sample name.
--create-bam true Generate a BAM file with aligned reads. Starting with Cell Ranger v8, BAM output is off by default; set to true if you need the BAM for downstream tools such as velocyto or variant calling.
--sample pbmc_10k_v3 The sample name prefix in the FASTQ file names. Cell Ranger selects files matching this prefix.
--localcores ${SLURM_CPUS_ON_NODE} Number of CPU cores to use. We set this to match the SLURM allocation so Cell Ranger does not try to use more cores than allocated.
--localmem 64 Maximum memory (in GB) that Cell Ranger is allowed to use.
Callout

What if I have multiple samples?

Q: I have 4 samples (WT_rep1, WT_rep2, KO_rep1, KO_rep2). Do I pass them all to one cellranger count command?

A: No. cellranger count processes one sample per invocation. Use a SLURM array job to run them in parallel:

BASH

#!/bin/bash
#SBATCH --array=0-3
#SBATCH --nodes=1
#SBATCH --ntasks=16
#SBATCH --time=1-00:00:00
#SBATCH --job-name=cellranger
#SBATCH --account=workshop

ml --force purge
ml biocontainers cellranger

SAMPLES=(WT_rep1 WT_rep2 KO_rep1 KO_rep2)
SAMPLE=${SAMPLES[$SLURM_ARRAY_TASK_ID]}

cd ${RCAC_SCRATCH}/scrna_workshop/cellranger_output

cellranger count \
    --id=${SAMPLE} \
    --transcriptome=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A \
    --fastqs=${RCAC_SCRATCH}/scrna_workshop/fastq \
    --create-bam true \
    --sample=${SAMPLE} \
    --localcores=${SLURM_CPUS_ON_NODE} \
    --localmem=64

For most downstream analyses, merge samples in Seurat (e.g., with merge() or IntegrateLayers()) rather than using cellranger aggr.

Cell Ranger output files

When the job completes, Cell Ranger creates the following directory structure:

BASH

ls ${RCAC_SCRATCH}/scrna_workshop/cellranger_output/pbmc10k/outs/

The key output files are:

pbmc10k/outs/
├── filtered_feature_bc_matrix/     # The count matrix (filtered to real cells)
│   ├── barcodes.tsv.gz             # List of cell barcodes
│   ├── features.tsv.gz             # List of genes
│   └── matrix.mtx.gz               # Sparse count matrix (MatrixMarket format)
├── raw_feature_bc_matrix/          # Count matrix for ALL barcodes (including empty drops)
├── web_summary.html                # Interactive QC report
├── metrics_summary.csv             # Key metrics as a CSV file
├── possorted_genome_bam.bam        # Aligned reads (large file)
└── molecule_info.h5                # Per-molecule info (used for aggregation)

The filtered_feature_bc_matrix/ directory is the most important output. It contains the UMI count matrix with only cell-containing barcodes (empty droplets have been removed by Cell Ranger’s cell calling algorithm). This is the file we will load into Seurat in the next episode.

The three files inside use the MatrixMarket sparse format:

  • barcodes.tsv.gz – one cell barcode per line
  • features.tsv.gz – one gene per line (Ensembl ID, gene symbol, feature type)
  • matrix.mtx.gz – the sparse matrix with row indices (genes), column indices (cells), and UMI counts
Callout

Interpreting web_summary.html

The web_summary.html file is an interactive HTML report that summarizes the quality of your Cell Ranger run. Open it in a web browser (you can copy it to your local machine with scp or view it through Open OnDemand). Here are the key metrics to check:

Metric Healthy range What it means
Estimated Number of Cells Matches expectations (e.g., ~10,000) The number of barcodes Cell Ranger identified as real cells.
Median Genes per Cell >1,000 for most tissues How many genes are detected in a typical cell. Very low values may indicate poor capture.
Reads Mapped Confidently to Transcriptome >50% Fraction of reads that align to annotated genes. Low values suggest reference mismatch or sample contamination.
Sequencing Saturation >50% for most experiments Fraction of reads that are PCR duplicates. Low saturation means more sequencing would detect additional UMIs. High saturation means you have enough sequencing depth.
Fraction Reads in Cells >70% Fraction of reads assigned to cell-containing barcodes. Low values may indicate high ambient RNA.

If any metric appears in red or orange in the web summary, investigate before proceeding to downstream analysis.

Interpreting Cell Ranger output

Screenshot of the Cell Ranger web_summary.html report for the PBMC 10k dataset showing key QC metrics
Cell Ranger web_summary.html for PBMC 10k

The web_summary.html file is the first thing to check after every Cell Ranger run. Here are the key QC metrics from our PBMC 10k run:

Metric Value What to look for
Estimated Number of Cells 11,809 Close to expected loading (~10k)
Median Genes per Cell 3,371 >1,000 for PBMCs is good
Reads Mapped Confidently to Transcriptome 79.1% >70% expected for 3’ GEX
Sequencing Saturation 68.2% >60% adequate; >80% ideal
Fraction Reads in Cells 95.7% >90% indicates clean cell calling
Valid Barcodes 97.3% >95% expected

A low Fraction Reads in Cells or low Median Genes per Cell would indicate problems with cell viability or library quality.

Callout

Sequencing saturation of 68.2%: is that enough?

A saturation of 68.2% means that roughly 32% of additional sequencing would yield new UMIs. For most differential expression and cell type identification workflows, this depth is sufficient. Diminishing returns set in above ~80% saturation, so deeper sequencing of this library would provide only marginal gains.

Processing with STARsolo


STARsolo is a single-cell RNA-seq processing mode built into the STAR aligner. It replicates the Cell Ranger pipeline – demultiplexing, alignment, barcode error correction, UMI deduplication, and cell filtering – but runs significantly faster because STAR is a highly optimized aligner. STARsolo is fully open source and produces results that are nearly identical to Cell Ranger.

Building a STAR genome index

STARsolo requires a STAR genome index. You can either build one from scratch or reuse the index that ships inside the Cell Ranger reference package. For this workshop, we will build a fresh index from the genome FASTA and GTF files included in the reference package. This ensures compatibility with the version of STAR installed on the cluster.

Callout

Reusing the Cell Ranger index

If you want to skip the index build, you can point STARsolo directly at the pre-built index inside the Cell Ranger reference: ${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A/star/. However, this only works if the STAR version on the cluster matches the version Cell Ranger used to build the index. If the versions differ, STAR will exit with an error and you will need to build a new index.

Create the index build script:

BASH

cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/build_star_index.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=star_index
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=star_index_%j.out
#SBATCH --error=star_index_%j.err

# Load modules
ml --force purge
ml biocontainers
ml star

REF=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A
STAR_INDEX=${RCAC_SCRATCH}/scrna_workshop/reference/star_index

mkdir -p ${STAR_INDEX}
gunzip -c ${REF}/genes/genes.gtf.gz > ${REF}/genes/genes.gtf
STAR \
    --runMode genomeGenerate \
    --runThreadN ${SLURM_CPUS_ON_NODE} \
    --genomeDir ${STAR_INDEX} \
    --genomeFastaFiles ${REF}/fasta/genome.fa \
    --sjdbGTFfile ${REF}/genes/genes.gtf
EOF

BASH

sbatch ${RCAC_SCRATCH}/scrna_workshop/build_star_index.sh

This step requires approximately 32 GB of RAM and takes about 30 minutes on 16 cores. The resulting index will be written to ${RCAC_SCRATCH}/scrna_workshop/reference/star_index/.

Running the STARsolo alignment

Once the index is ready, create the STARsolo alignment script. Note an important difference from Cell Ranger: STAR expects the cDNA read (R2) first, followed by the barcode read (R1) in the --readFilesIn argument.

BASH

cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/run_starsolo.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=starsolo
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=starsolo_%j.out
#SBATCH --error=starsolo_%j.err

# Load modules
ml --force purge
ml biocontainers
ml star

# Define paths
FASTQ=${RCAC_SCRATCH}/scrna_workshop/fastq
STAR_INDEX=${RCAC_SCRATCH}/scrna_workshop/reference/star_index
WHITELIST=${RCAC_SCRATCH}/scrna_workshop/reference/3M-february-2018.txt

cd ${RCAC_SCRATCH}/scrna_workshop/starsolo_output

STAR \
    --runThreadN ${SLURM_CPUS_ON_NODE} \
    --genomeDir ${STAR_INDEX} \
    --sjdbGTFfile ${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A/genes/genes.gtf \
    --readFilesIn \
        ${FASTQ}/pbmc_10k_v3_S1_L001_R2_001.fastq.gz,${FASTQ}/pbmc_10k_v3_S1_L002_R2_001.fastq.gz \
        ${FASTQ}/pbmc_10k_v3_S1_L001_R1_001.fastq.gz,${FASTQ}/pbmc_10k_v3_S1_L002_R1_001.fastq.gz \
    --readFilesCommand zcat \
    --soloType CB_UMI_Simple \
    --soloCBwhitelist ${WHITELIST} \
    --soloCBstart 1 \
    --soloCBlen 16 \
    --soloUMIstart 17 \
    --soloUMIlen 12 \
    --soloBarcodeMate 0 \
    --soloCBmatchWLtype 1MM_multi_Nbase_pseudocounts \
    --soloUMIfiltering MultiGeneUMI_CR \
    --soloUMIdedup 1MM_CR \
    --clipAdapterType CellRanger4 \
    --soloCellFilter EmptyDrops_CR \
    --outSAMtype BAM SortedByCoordinate \
    --outSAMattributes CR UR CY UY CB UB \
    --outFileNamePrefix starsolo_pbmc10k_
EOF

Submit the job:

BASH

sbatch ${RCAC_SCRATCH}/scrna_workshop/run_starsolo.sh

STARsolo parameter reference

Parameter Value Description
--runThreadN ${SLURM_CPUS_ON_NODE} Number of threads. Matches the SLURM allocation.
--genomeDir .../star_index Path to the STAR genome index directory.
--sjdbGTFfile .../genes/genes.gtf Gene annotation GTF file for splice junction detection and gene counting.
--readFilesIn R2_L001,R2_L002 R1_L001,R1_L002 Input FASTQ files. Important: the cDNA read (R2) comes first, then the barcode read (R1). Multiple lanes are comma-separated within each read group; a space separates R2 from R1.
--readFilesCommand zcat Decompression command for gzipped FASTQ files.
--soloType CB_UMI_Simple Barcode geometry: a single cell barcode followed by a UMI on the barcode read. This is the standard layout for 10x Chromium libraries.
--soloCBwhitelist .../3M-february-2018.txt The 10x barcode whitelist file. This contains all 3.7 million valid cell barcode sequences for v3 chemistry.
--soloCBstart 1 Position where the cell barcode starts on the barcode read (1-based).
--soloCBlen 16 Length of the cell barcode in bases.
--soloUMIstart 17 Position where the UMI starts on the barcode read (immediately after the cell barcode).
--soloUMIlen 12 Length of the UMI in bases. For 10x v3 chemistry this is 12; for v2 chemistry it is 10.
--soloBarcodeMate 0 Which mate carries the barcode. 0 means the barcode is on a separate read (R1), not embedded in the cDNA read.
--soloCBmatchWLtype 1MM_multi_Nbase_pseudocounts Barcode error correction strategy. Allows 1 mismatch when matching to the whitelist, handles N bases, and uses pseudocounts to resolve ambiguous corrections. This matches Cell Ranger’s correction algorithm.
--soloUMIfiltering MultiGeneUMI_CR Filters UMIs that map to multiple genes using the Cell Ranger algorithm.
--soloUMIdedup 1MM_CR UMI deduplication strategy allowing 1 mismatch, matching Cell Ranger’s approach.
--clipAdapterType CellRanger4 Clips adapter sequences using the same method as Cell Ranger 4+.
--soloCellFilter EmptyDrops_CR Cell calling algorithm. EmptyDrops_CR replicates Cell Ranger’s EmptyDrops-based method for distinguishing real cells from empty droplets.
--outSAMtype BAM SortedByCoordinate Output a coordinate-sorted BAM file.
--outSAMattributes CR UR CY UY CB UB Include cell barcode and UMI tags in the BAM file (raw and error-corrected versions plus quality scores).
--outFileNamePrefix starsolo_pbmc10k_ Prefix for all output file names.

STARsolo output files

STARsolo writes the count matrices under Solo.out/ inside the output directory:

BASH

ls ${RCAC_SCRATCH}/scrna_workshop/starsolo_output/starsolo_pbmc10k_Solo.out/Gene/filtered/

OUTPUT

barcodes.tsv  features.tsv  matrix.mtx

The filtered directory contains three files in the same format as Cell Ranger:

  • barcodes.tsv – cell barcodes that passed the EmptyDrops cell filter
  • features.tsv – gene identifiers (Ensembl ID and gene symbol)
  • matrix.mtx – the sparse UMI count matrix in MatrixMarket format

Note that STARsolo’s output files are uncompressed (.tsv and .mtx rather than .tsv.gz and .mtx.gz). Seurat’s Read10X() function handles both compressed and uncompressed formats automatically.

Callout

Runtime comparison

On 64 cores with the PBMC 10k v3 dataset, typical runtimes are:

  • Cell Ranger: ~7 hours
  • STARsolo: ~45 minutes

STARsolo is roughly 9x faster because STAR is a highly optimized C++ aligner, while Cell Ranger wraps STAR with additional Python and Java orchestration layers. Both produce nearly identical count matrices.

Interpreting STARsolo output

STARsolo writes alignment statistics to Log.final.out in the output directory. Here are the key metrics from our PBMC 10k run:

Metric Value What to look for
Uniquely mapped reads % 89.28% >80% for human GEX
Multi-mapping reads % 7.14% <10% typical
Unmapped: too short % 2.56% >10% suggests trimming or degradation
Mismatch rate per base 0.56% <1% expected
Mapping speed 923.7M reads/hr ~15x faster than Cell Ranger for this run

Unlike Cell Ranger, STARsolo does not produce an HTML summary report. Check Log.final.out for alignment statistics and Solo.out/Gene/Summary.csv for cell-level metrics such as the number of cells detected and UMIs per cell.

Comparing Outputs


Now that both tools have finished, let’s compare their outputs. We can count the number of cells (barcodes) and genes (features) detected by each tool directly from the output files.

Cell Ranger:

BASH

echo "Cell Ranger cells:"
zcat ${RCAC_SCRATCH}/scrna_workshop/cellranger_output/pbmc10k/outs/filtered_feature_bc_matrix/barcodes.tsv.gz | wc -l

echo "Cell Ranger genes:"
zcat ${RCAC_SCRATCH}/scrna_workshop/cellranger_output/pbmc10k/outs/filtered_feature_bc_matrix/features.tsv.gz | wc -l

STARsolo:

BASH

echo "STARsolo cells:"
wc -l < ${RCAC_SCRATCH}/scrna_workshop/starsolo_output/starsolo_pbmc10k_Solo.out/Gene/filtered/barcodes.tsv

echo "STARsolo genes:"
wc -l < ${RCAC_SCRATCH}/scrna_workshop/starsolo_output/starsolo_pbmc10k_Solo.out/Gene/filtered/features.tsv

Both tools should report very similar numbers:

OUTPUT

Cell Ranger cells:
11809
Cell Ranger genes:
38606

STARsolo cells:
11682
STARsolo genes:
38606

The cell counts may differ by a small amount (typically <1%) due to minor differences in the EmptyDrops cell-calling implementation. The gene count is identical because both tools use the same reference annotation.

When to use each tool

Use Cell Ranger when:

  • You need results that are directly comparable to 10x Genomics documentation and publications
  • You want the interactive web_summary.html report
  • Your institution has Cell Ranger installed and you don’t need to worry about licensing
  • You are running the standard 10x Chromium workflow with no custom modifications

Use STARsolo when:

  • You need faster turnaround (especially important for large datasets or parameter sweeps)
  • You need a fully open-source pipeline
  • You are working with non-standard barcode configurations or custom protocols
  • You want fine-grained control over alignment and counting parameters

For this workshop, the pre-computed filtered_feature_bc_matrix/ in the workshop data directory was generated with Cell Ranger. We will use it for all downstream analysis starting in the next episode.

Challenge

Challenge 1: Modify STARsolo for v2 Chemistry

The PBMC 10k dataset uses 10x Chromium v3 chemistry (16 bp barcode + 12 bp UMI). Older experiments used v2 chemistry, which has a different UMI length and barcode whitelist.

What parameters in the STARsolo command would you change to process a v2 chemistry library? (Hint: two parameters change and one additional parameter needs a different file.)

Three changes are required for v2 chemistry:

  1. --soloUMIlen 10 instead of 12. v2 chemistry uses 10 bp UMIs (compared to 12 bp in v3).

  2. --soloCBwhitelist must point to the v2 whitelist file (737K-august-2016.txt) instead of the v3 whitelist (3M-february-2018.txt). The v2 whitelist contains ~737,000 valid barcodes; the v3 whitelist contains ~3.7 million.

  3. --soloCBlen 16 stays the same – both v2 and v3 use 16 bp cell barcodes. The cell barcode length did not change between chemistry versions.

The updated parameters would look like:

BASH

    --soloCBwhitelist /path/to/737K-august-2016.txt \
    --soloCBlen 16 \
    --soloUMIstart 17 \
    --soloUMIlen 10 \

Always check the chemistry version in your experiment’s documentation or the web_summary.html from a previous Cell Ranger run. Using the wrong whitelist or UMI length will result in very few cells being detected.

Challenge

Challenge 2: QC from Cell Ranger Summary

A colleague shares their Cell Ranger metrics_summary.csv with the following values. Review the metrics and identify which one suggests a potential quality concern.

Metric Value
Estimated Number of Cells 8,500
Mean Reads per Cell 45,000
Median Genes per Cell 2,100
Fraction Reads in Cells 55.2%
Reads Mapped Confidently to Transcriptome 62.5%
Sequencing Saturation 28.3%

Two metrics stand out:

  1. Fraction Reads in Cells (55.2%) is low. A healthy value is typically >70%. When nearly half of all reads come from non-cell barcodes, it indicates a high level of ambient RNA (free-floating mRNA from lysed cells in the droplet suspension). This does not necessarily mean the experiment failed, but it means a large fraction of the sequencing budget was spent on background noise. Downstream tools like SoupX or CellBender can help correct for ambient RNA contamination.

  2. Sequencing Saturation (28.3%) is low. This means that 71.7% of the reads are still detecting new UMIs – in other words, additional sequencing would reveal more unique transcripts. A value below 50% suggests the library was under-sequenced. If the budget allows, resequencing the same library would improve gene detection. However, for some applications (e.g., cell type identification), 28% saturation may still be sufficient.

The other metrics look reasonable: 8,500 cells is within expectations for a standard 10x run, median genes per cell >2,000 indicates decent capture quality, and 62.5% reads mapped to transcriptome is acceptable for a human sample.

Key Points
  • Workshop data should be organized under ${RCAC_SCRATCH}/scrna_workshop/ with separate directories for FASTQ files, reference, and outputs
  • Cell Ranger count aligns 10x FASTQ files and produces a filtered count matrix, a web summary report, and alignment metrics
  • STARsolo replicates Cell Ranger’s pipeline but runs approximately 9x faster and is fully open source
  • Both tools produce a filtered count matrix in the same format: barcodes.tsv, features.tsv, and matrix.mtx
  • Always inspect the Cell Ranger web_summary.html to check estimated cell count, median genes per cell, sequencing saturation, and fraction of reads in cells before proceeding