Raw Data Processing
Last updated on 2026-09-08 | Edit this page
Estimated time: 60 minutes
Overview
Questions
- How do we organize scRNA-seq data files on an HPC cluster?
- How do we align 10x Chromium FASTQ files with Cell Ranger?
- How do we run STARsolo as an open-source alternative?
- How do the outputs from Cell Ranger and STARsolo compare?
Objectives
- Set up a working directory and verify FASTQ and reference files on the cluster
- Write and submit a SLURM job script for Cell Ranger count
- Write and submit a SLURM job script for STARsolo
- Interpret Cell Ranger’s web_summary.html and key QC metrics
- Compare the filtered count matrices produced by both tools
Prerequisites
This episode requires an active account on Purdue’s Negishi cluster
and familiarity with basic Linux commands (cd,
ls, mkdir, cat). You should be
comfortable submitting SLURM jobs with sbatch and
monitoring them with squeue. This episode requires shell
access to the Negishi cluster via SSH. See the SSH Setup section for connection
instructions.
Cell Ranger Licensing
Cell Ranger is proprietary software from 10x Genomics. It is free to download and use, but it requires acceptance of the 10x Genomics End User License Agreement. STARsolo is fully open source (MIT license) and produces equivalent results. If you cannot use Cell Ranger due to licensing constraints, STARsolo is an excellent alternative. This workshop covers both tools so you can choose whichever is appropriate for your situation.
Data Organization
Before running any alignment, we need a clean directory structure.
All workshop files live under
${RCAC_SCRATCH}/scrna_workshop/. Let’s create the directory
layout and copy the data.
This creates the following structure:
${RCAC_SCRATCH}/scrna_workshop/
├── fastq/ # Raw FASTQ files
├── reference/ # Reference genome and index
├── cellranger_output/ # Cell Ranger results
└── starsolo_output/ # STARsolo results
Now copy the pre-staged workshop data from the shared depot:
Extract the 10x barcode whitelist from the Cell Ranger container (needed for STARsolo):
BASH
module load biocontainers
singularity exec ${BIOC_IMAGE_DIR}/cumulusprod_cellranger:10.0.0.sif \
zcat /software/cellranger-10.0.0/lib/python/cellranger/barcodes/3M-february-2018_TRU.txt.gz \
> ${RCAC_SCRATCH}/scrna_workshop/reference/3M-february-2018.txt
Verify that the FASTQ files are present:
OUTPUT
pbmc_10k_v3_S1_L001_I1_001.fastq.gz
pbmc_10k_v3_S1_L001_R1_001.fastq.gz
pbmc_10k_v3_S1_L001_R2_001.fastq.gz
pbmc_10k_v3_S1_L002_I1_001.fastq.gz
pbmc_10k_v3_S1_L002_R1_001.fastq.gz
pbmc_10k_v3_S1_L002_R2_001.fastq.gz
Verify that the reference genome is present:
OUTPUT
3M-february-2018.txt refdata-gex-GRCh38-2024-A
Understanding the FASTQ file names
The file names follow the 10x Genomics naming convention:
pbmc_10k_v3_S1_L001_R1_001.fastq.gz
│ │ │ │ └── File number (always 001 for single-file lanes)
│ │ │ └────── Read type: R1 or R2
│ │ └─────────── Lane number: L001 or L002
│ └────────────── Sample index: S1
└─────────────────────────── Sample name
This dataset was sequenced across two lanes (L001, L002), producing four files total: two lanes times two reads per lane.
What is in each read?
Read 1 (R1) contains the cell barcode and UMI. It is 28 bp long: the first 16 bases are the cell barcode (which cell this read came from) and the next 12 bases are the UMI (which original mRNA molecule this read represents). Read 1 does not contain any transcript sequence.
Read 2 (R2) contains the cDNA insert. This is the actual transcript fragment that gets mapped to the reference genome to determine which gene the mRNA came from. It is typically 90–150 bp long.
Let’s inspect the first few reads from each file to see this in practice:
You will see two FASTQ records. Each record has four lines: a header
line starting with @, the sequence, a +
separator, and quality scores. Notice that every R1 sequence is exactly
28 bp – that is the 16 bp cell barcode followed by the 12 bp UMI.
OUTPUT
@A00228:279:HFWFVDMXX:1:1101:3260:1000 1:N:0:NCAAGATG
NACCAACAGTCGAATAGTGTCATCTGCT
+
#FFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00228:279:HFWFVDMXX:1:1101:3821:1000 1:N:0:NCAAGATG
NTGTCTTAGCCTAGGACGGCCTCCGCCA
+
#FFFFFFFFFFFFFFFFFFFFFFFFFFF
R2 reads are longer (91 bp in this dataset) and contain transcript sequence that will be mapped to the genome.
OUTPUT
@A00228:279:HFWFVDMXX:1:1101:3260:1000 2:N:0:NCAAGATG
NTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAA
+
#FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00228:279:HFWFVDMXX:1:1101:3821:1000 2:N:0:NCAAGATG
NTTCTATTGGAAACCCGGTCTTTACAAAAAAATACAAAAATCAGCTGGGCGTTGGCCGCGCGTGGTGGCTCACACCTGTAATCTCAGCACT
+
#FFFFFFFFFFFFFFFFFFFFFF:,FFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF:FFFFFF:FFF:F:FFFFFFFFFFFFFFF
The reference genome
The reference genome is a 10x Genomics pre-built package based on the human GRCh38 assembly. This package contains everything Cell Ranger needs to align reads:
OUTPUT
fasta/ genes/ reference.json star/
The key components are:
-
fasta/genome.fa– the genome sequence (FASTA) -
genes/genes.gtf– the gene annotation (GTF) -
star/– a pre-built STAR genome index (used internally by Cell Ranger) -
reference.json– metadata about the reference build
Both Cell Ranger and STARsolo use STAR for alignment under the hood. Cell Ranger ships its own bundled STAR binary and uses the index inside this reference package. For STARsolo, we can either build our own STAR index or reuse the one inside this package.
Processing with Cell Ranger
Cell Ranger is the official analysis pipeline from 10x Genomics. The
cellranger count command takes FASTQ files and a reference
genome as input and produces a filtered UMI count matrix as output. We
will run it as a SLURM batch job on Negishi.
Create the job script:
BASH
cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/run_cellranger.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=cellranger
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=cellranger_%j.out
#SBATCH --error=cellranger_%j.err
# Load modules
ml --force purge
ml biocontainers
ml cellranger
# Move to the output directory
cd ${RCAC_SCRATCH}/scrna_workshop/cellranger_output
# Run Cell Ranger count
cellranger count \
--id=pbmc10k \
--transcriptome=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A \
--fastqs=${RCAC_SCRATCH}/scrna_workshop/fastq \
--create-bam true \
--sample=pbmc_10k_v3 \
--localcores=${SLURM_CPUS_ON_NODE} \
--localmem=100
EOF
Submit the job and monitor its progress:
The job typically takes 30–60 minutes on 16 cores, depending on cluster load.
Cell Ranger count parameters
| Parameter | Value | Description |
|---|---|---|
--id |
pbmc10k |
A unique run ID. Cell Ranger creates an output directory with this name. |
--transcriptome |
.../refdata-gex-GRCh38-2024-A |
Path to the 10x-compatible reference genome package containing the FASTA, GTF, and STAR index. |
--fastqs |
.../fastq |
Directory containing the FASTQ files. Cell Ranger auto-detects files matching the sample name. |
--create-bam |
true |
Generate a BAM file with aligned reads. Starting with Cell Ranger
v8, BAM output is off by default; set to true if you need
the BAM for downstream tools such as velocyto or variant calling. |
--sample |
pbmc_10k_v3 |
The sample name prefix in the FASTQ file names. Cell Ranger selects files matching this prefix. |
--localcores |
${SLURM_CPUS_ON_NODE} |
Number of CPU cores to use. We set this to match the SLURM allocation so Cell Ranger does not try to use more cores than allocated. |
--localmem |
64 |
Maximum memory (in GB) that Cell Ranger is allowed to use. |
What if I have multiple samples?
Q: I have 4 samples (WT_rep1, WT_rep2, KO_rep1,
KO_rep2). Do I pass them all to one cellranger count
command?
A: No. cellranger count processes
one sample per invocation. Use a SLURM array job to run
them in parallel:
BASH
#!/bin/bash
#SBATCH --array=0-3
#SBATCH --nodes=1
#SBATCH --ntasks=16
#SBATCH --time=1-00:00:00
#SBATCH --job-name=cellranger
#SBATCH --account=workshop
ml --force purge
ml biocontainers cellranger
SAMPLES=(WT_rep1 WT_rep2 KO_rep1 KO_rep2)
SAMPLE=${SAMPLES[$SLURM_ARRAY_TASK_ID]}
cd ${RCAC_SCRATCH}/scrna_workshop/cellranger_output
cellranger count \
--id=${SAMPLE} \
--transcriptome=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A \
--fastqs=${RCAC_SCRATCH}/scrna_workshop/fastq \
--create-bam true \
--sample=${SAMPLE} \
--localcores=${SLURM_CPUS_ON_NODE} \
--localmem=64
For most downstream analyses, merge samples in Seurat (e.g., with
merge() or IntegrateLayers()) rather than
using cellranger aggr.
Cell Ranger output files
When the job completes, Cell Ranger creates the following directory structure:
The key output files are:
pbmc10k/outs/
├── filtered_feature_bc_matrix/ # The count matrix (filtered to real cells)
│ ├── barcodes.tsv.gz # List of cell barcodes
│ ├── features.tsv.gz # List of genes
│ └── matrix.mtx.gz # Sparse count matrix (MatrixMarket format)
├── raw_feature_bc_matrix/ # Count matrix for ALL barcodes (including empty drops)
├── web_summary.html # Interactive QC report
├── metrics_summary.csv # Key metrics as a CSV file
├── possorted_genome_bam.bam # Aligned reads (large file)
└── molecule_info.h5 # Per-molecule info (used for aggregation)
The filtered_feature_bc_matrix/ directory is the most important output. It contains the UMI count matrix with only cell-containing barcodes (empty droplets have been removed by Cell Ranger’s cell calling algorithm). This is the file we will load into Seurat in the next episode.
The three files inside use the MatrixMarket sparse format:
- barcodes.tsv.gz – one cell barcode per line
- features.tsv.gz – one gene per line (Ensembl ID, gene symbol, feature type)
- matrix.mtx.gz – the sparse matrix with row indices (genes), column indices (cells), and UMI counts
Interpreting web_summary.html
The web_summary.html file is an interactive HTML report
that summarizes the quality of your Cell Ranger run. Open it in a web
browser (you can copy it to your local machine with scp or
view it through Open OnDemand). Here are the key metrics to check:
| Metric | Healthy range | What it means |
|---|---|---|
| Estimated Number of Cells | Matches expectations (e.g., ~10,000) | The number of barcodes Cell Ranger identified as real cells. |
| Median Genes per Cell | >1,000 for most tissues | How many genes are detected in a typical cell. Very low values may indicate poor capture. |
| Reads Mapped Confidently to Transcriptome | >50% | Fraction of reads that align to annotated genes. Low values suggest reference mismatch or sample contamination. |
| Sequencing Saturation | >50% for most experiments | Fraction of reads that are PCR duplicates. Low saturation means more sequencing would detect additional UMIs. High saturation means you have enough sequencing depth. |
| Fraction Reads in Cells | >70% | Fraction of reads assigned to cell-containing barcodes. Low values may indicate high ambient RNA. |
If any metric appears in red or orange in the web summary, investigate before proceeding to downstream analysis.
Interpreting Cell Ranger output

The web_summary.html file is the first thing to check
after every Cell Ranger run. Here are the key QC metrics from our PBMC
10k run:
| Metric | Value | What to look for |
|---|---|---|
| Estimated Number of Cells | 11,809 | Close to expected loading (~10k) |
| Median Genes per Cell | 3,371 | >1,000 for PBMCs is good |
| Reads Mapped Confidently to Transcriptome | 79.1% | >70% expected for 3’ GEX |
| Sequencing Saturation | 68.2% | >60% adequate; >80% ideal |
| Fraction Reads in Cells | 95.7% | >90% indicates clean cell calling |
| Valid Barcodes | 97.3% | >95% expected |
A low Fraction Reads in Cells or low Median Genes per Cell would indicate problems with cell viability or library quality.
Sequencing saturation of 68.2%: is that enough?
A saturation of 68.2% means that roughly 32% of additional sequencing would yield new UMIs. For most differential expression and cell type identification workflows, this depth is sufficient. Diminishing returns set in above ~80% saturation, so deeper sequencing of this library would provide only marginal gains.
Processing with STARsolo
STARsolo is a single-cell RNA-seq processing mode built into the STAR aligner. It replicates the Cell Ranger pipeline – demultiplexing, alignment, barcode error correction, UMI deduplication, and cell filtering – but runs significantly faster because STAR is a highly optimized aligner. STARsolo is fully open source and produces results that are nearly identical to Cell Ranger.
Building a STAR genome index
STARsolo requires a STAR genome index. You can either build one from scratch or reuse the index that ships inside the Cell Ranger reference package. For this workshop, we will build a fresh index from the genome FASTA and GTF files included in the reference package. This ensures compatibility with the version of STAR installed on the cluster.
Reusing the Cell Ranger index
If you want to skip the index build, you can point STARsolo directly
at the pre-built index inside the Cell Ranger reference:
${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A/star/.
However, this only works if the STAR version on the cluster matches the
version Cell Ranger used to build the index. If the versions differ,
STAR will exit with an error and you will need to build a new index.
Create the index build script:
BASH
cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/build_star_index.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=star_index
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=star_index_%j.out
#SBATCH --error=star_index_%j.err
# Load modules
ml --force purge
ml biocontainers
ml star
REF=${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A
STAR_INDEX=${RCAC_SCRATCH}/scrna_workshop/reference/star_index
mkdir -p ${STAR_INDEX}
gunzip -c ${REF}/genes/genes.gtf.gz > ${REF}/genes/genes.gtf
STAR \
--runMode genomeGenerate \
--runThreadN ${SLURM_CPUS_ON_NODE} \
--genomeDir ${STAR_INDEX} \
--genomeFastaFiles ${REF}/fasta/genome.fa \
--sjdbGTFfile ${REF}/genes/genes.gtf
EOF
This step requires approximately 32 GB of RAM and takes about 30
minutes on 16 cores. The resulting index will be written to
${RCAC_SCRATCH}/scrna_workshop/reference/star_index/.
Running the STARsolo alignment
Once the index is ready, create the STARsolo alignment script. Note
an important difference from Cell Ranger: STAR expects the cDNA
read (R2) first, followed by the barcode read (R1) in the
--readFilesIn argument.
BASH
cat << 'EOF' > ${RCAC_SCRATCH}/scrna_workshop/run_starsolo.sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH --ntasks=64
#SBATCH --time=1-00:00:00
#SBATCH --job-name=starsolo
#SBATCH --account=workshop
#SBATCH --partition=cpu
#SBATCH --output=starsolo_%j.out
#SBATCH --error=starsolo_%j.err
# Load modules
ml --force purge
ml biocontainers
ml star
# Define paths
FASTQ=${RCAC_SCRATCH}/scrna_workshop/fastq
STAR_INDEX=${RCAC_SCRATCH}/scrna_workshop/reference/star_index
WHITELIST=${RCAC_SCRATCH}/scrna_workshop/reference/3M-february-2018.txt
cd ${RCAC_SCRATCH}/scrna_workshop/starsolo_output
STAR \
--runThreadN ${SLURM_CPUS_ON_NODE} \
--genomeDir ${STAR_INDEX} \
--sjdbGTFfile ${RCAC_SCRATCH}/scrna_workshop/reference/refdata-gex-GRCh38-2024-A/genes/genes.gtf \
--readFilesIn \
${FASTQ}/pbmc_10k_v3_S1_L001_R2_001.fastq.gz,${FASTQ}/pbmc_10k_v3_S1_L002_R2_001.fastq.gz \
${FASTQ}/pbmc_10k_v3_S1_L001_R1_001.fastq.gz,${FASTQ}/pbmc_10k_v3_S1_L002_R1_001.fastq.gz \
--readFilesCommand zcat \
--soloType CB_UMI_Simple \
--soloCBwhitelist ${WHITELIST} \
--soloCBstart 1 \
--soloCBlen 16 \
--soloUMIstart 17 \
--soloUMIlen 12 \
--soloBarcodeMate 0 \
--soloCBmatchWLtype 1MM_multi_Nbase_pseudocounts \
--soloUMIfiltering MultiGeneUMI_CR \
--soloUMIdedup 1MM_CR \
--clipAdapterType CellRanger4 \
--soloCellFilter EmptyDrops_CR \
--outSAMtype BAM SortedByCoordinate \
--outSAMattributes CR UR CY UY CB UB \
--outFileNamePrefix starsolo_pbmc10k_
EOF
Submit the job:
STARsolo parameter reference
| Parameter | Value | Description |
|---|---|---|
--runThreadN |
${SLURM_CPUS_ON_NODE} |
Number of threads. Matches the SLURM allocation. |
--genomeDir |
.../star_index |
Path to the STAR genome index directory. |
--sjdbGTFfile |
.../genes/genes.gtf |
Gene annotation GTF file for splice junction detection and gene counting. |
--readFilesIn |
R2_L001,R2_L002 R1_L001,R1_L002 |
Input FASTQ files. Important: the cDNA read (R2) comes first, then the barcode read (R1). Multiple lanes are comma-separated within each read group; a space separates R2 from R1. |
--readFilesCommand |
zcat |
Decompression command for gzipped FASTQ files. |
--soloType |
CB_UMI_Simple |
Barcode geometry: a single cell barcode followed by a UMI on the barcode read. This is the standard layout for 10x Chromium libraries. |
--soloCBwhitelist |
.../3M-february-2018.txt |
The 10x barcode whitelist file. This contains all 3.7 million valid cell barcode sequences for v3 chemistry. |
--soloCBstart |
1 |
Position where the cell barcode starts on the barcode read (1-based). |
--soloCBlen |
16 |
Length of the cell barcode in bases. |
--soloUMIstart |
17 |
Position where the UMI starts on the barcode read (immediately after the cell barcode). |
--soloUMIlen |
12 |
Length of the UMI in bases. For 10x v3 chemistry this is 12; for v2 chemistry it is 10. |
--soloBarcodeMate |
0 |
Which mate carries the barcode. 0 means the barcode is
on a separate read (R1), not embedded in the cDNA read. |
--soloCBmatchWLtype |
1MM_multi_Nbase_pseudocounts |
Barcode error correction strategy. Allows 1 mismatch when matching to the whitelist, handles N bases, and uses pseudocounts to resolve ambiguous corrections. This matches Cell Ranger’s correction algorithm. |
--soloUMIfiltering |
MultiGeneUMI_CR |
Filters UMIs that map to multiple genes using the Cell Ranger algorithm. |
--soloUMIdedup |
1MM_CR |
UMI deduplication strategy allowing 1 mismatch, matching Cell Ranger’s approach. |
--clipAdapterType |
CellRanger4 |
Clips adapter sequences using the same method as Cell Ranger 4+. |
--soloCellFilter |
EmptyDrops_CR |
Cell calling algorithm. EmptyDrops_CR replicates Cell
Ranger’s EmptyDrops-based method for distinguishing real cells from
empty droplets. |
--outSAMtype |
BAM SortedByCoordinate |
Output a coordinate-sorted BAM file. |
--outSAMattributes |
CR UR CY UY CB UB |
Include cell barcode and UMI tags in the BAM file (raw and error-corrected versions plus quality scores). |
--outFileNamePrefix |
starsolo_pbmc10k_ |
Prefix for all output file names. |
STARsolo output files
STARsolo writes the count matrices under Solo.out/
inside the output directory:
OUTPUT
barcodes.tsv features.tsv matrix.mtx
The filtered directory contains three files in the same format as Cell Ranger:
- barcodes.tsv – cell barcodes that passed the EmptyDrops cell filter
- features.tsv – gene identifiers (Ensembl ID and gene symbol)
- matrix.mtx – the sparse UMI count matrix in MatrixMarket format
Note that STARsolo’s output files are uncompressed
(.tsv and .mtx rather than
.tsv.gz and .mtx.gz). Seurat’s
Read10X() function handles both compressed and uncompressed
formats automatically.
Runtime comparison
On 64 cores with the PBMC 10k v3 dataset, typical runtimes are:
- Cell Ranger: ~7 hours
- STARsolo: ~45 minutes
STARsolo is roughly 9x faster because STAR is a highly optimized C++ aligner, while Cell Ranger wraps STAR with additional Python and Java orchestration layers. Both produce nearly identical count matrices.
Interpreting STARsolo output
STARsolo writes alignment statistics to Log.final.out in
the output directory. Here are the key metrics from our PBMC 10k
run:
| Metric | Value | What to look for |
|---|---|---|
| Uniquely mapped reads % | 89.28% | >80% for human GEX |
| Multi-mapping reads % | 7.14% | <10% typical |
| Unmapped: too short % | 2.56% | >10% suggests trimming or degradation |
| Mismatch rate per base | 0.56% | <1% expected |
| Mapping speed | 923.7M reads/hr | ~15x faster than Cell Ranger for this run |
Unlike Cell Ranger, STARsolo does not produce an HTML summary report.
Check Log.final.out for alignment statistics and
Solo.out/Gene/Summary.csv for cell-level metrics such as
the number of cells detected and UMIs per cell.
Comparing Outputs
Now that both tools have finished, let’s compare their outputs. We can count the number of cells (barcodes) and genes (features) detected by each tool directly from the output files.
Cell Ranger:
BASH
echo "Cell Ranger cells:"
zcat ${RCAC_SCRATCH}/scrna_workshop/cellranger_output/pbmc10k/outs/filtered_feature_bc_matrix/barcodes.tsv.gz | wc -l
echo "Cell Ranger genes:"
zcat ${RCAC_SCRATCH}/scrna_workshop/cellranger_output/pbmc10k/outs/filtered_feature_bc_matrix/features.tsv.gz | wc -l
STARsolo:
BASH
echo "STARsolo cells:"
wc -l < ${RCAC_SCRATCH}/scrna_workshop/starsolo_output/starsolo_pbmc10k_Solo.out/Gene/filtered/barcodes.tsv
echo "STARsolo genes:"
wc -l < ${RCAC_SCRATCH}/scrna_workshop/starsolo_output/starsolo_pbmc10k_Solo.out/Gene/filtered/features.tsv
Both tools should report very similar numbers:
OUTPUT
Cell Ranger cells:
11809
Cell Ranger genes:
38606
STARsolo cells:
11682
STARsolo genes:
38606
The cell counts may differ by a small amount (typically <1%) due to minor differences in the EmptyDrops cell-calling implementation. The gene count is identical because both tools use the same reference annotation.
When to use each tool
Use Cell Ranger when:
- You need results that are directly comparable to 10x Genomics documentation and publications
- You want the interactive
web_summary.htmlreport - Your institution has Cell Ranger installed and you don’t need to worry about licensing
- You are running the standard 10x Chromium workflow with no custom modifications
Use STARsolo when:
- You need faster turnaround (especially important for large datasets or parameter sweeps)
- You need a fully open-source pipeline
- You are working with non-standard barcode configurations or custom protocols
- You want fine-grained control over alignment and counting parameters
For this workshop, the pre-computed
filtered_feature_bc_matrix/ in the workshop data directory
was generated with Cell Ranger. We will use it for all downstream
analysis starting in the next episode.
Challenge 1: Modify STARsolo for v2 Chemistry
The PBMC 10k dataset uses 10x Chromium v3 chemistry (16 bp barcode + 12 bp UMI). Older experiments used v2 chemistry, which has a different UMI length and barcode whitelist.
What parameters in the STARsolo command would you change to process a v2 chemistry library? (Hint: two parameters change and one additional parameter needs a different file.)
Three changes are required for v2 chemistry:
--soloUMIlen 10instead of12. v2 chemistry uses 10 bp UMIs (compared to 12 bp in v3).--soloCBwhitelistmust point to the v2 whitelist file (737K-august-2016.txt) instead of the v3 whitelist (3M-february-2018.txt). The v2 whitelist contains ~737,000 valid barcodes; the v3 whitelist contains ~3.7 million.--soloCBlen 16stays the same – both v2 and v3 use 16 bp cell barcodes. The cell barcode length did not change between chemistry versions.
The updated parameters would look like:
BASH
--soloCBwhitelist /path/to/737K-august-2016.txt \
--soloCBlen 16 \
--soloUMIstart 17 \
--soloUMIlen 10 \
Always check the chemistry version in your experiment’s documentation
or the web_summary.html from a previous Cell Ranger run.
Using the wrong whitelist or UMI length will result in very few cells
being detected.
Challenge 2: QC from Cell Ranger Summary
A colleague shares their Cell Ranger metrics_summary.csv
with the following values. Review the metrics and identify which one
suggests a potential quality concern.
| Metric | Value |
|---|---|
| Estimated Number of Cells | 8,500 |
| Mean Reads per Cell | 45,000 |
| Median Genes per Cell | 2,100 |
| Fraction Reads in Cells | 55.2% |
| Reads Mapped Confidently to Transcriptome | 62.5% |
| Sequencing Saturation | 28.3% |
Two metrics stand out:
Fraction Reads in Cells (55.2%) is low. A healthy value is typically >70%. When nearly half of all reads come from non-cell barcodes, it indicates a high level of ambient RNA (free-floating mRNA from lysed cells in the droplet suspension). This does not necessarily mean the experiment failed, but it means a large fraction of the sequencing budget was spent on background noise. Downstream tools like SoupX or CellBender can help correct for ambient RNA contamination.
Sequencing Saturation (28.3%) is low. This means that 71.7% of the reads are still detecting new UMIs – in other words, additional sequencing would reveal more unique transcripts. A value below 50% suggests the library was under-sequenced. If the budget allows, resequencing the same library would improve gene detection. However, for some applications (e.g., cell type identification), 28% saturation may still be sufficient.
The other metrics look reasonable: 8,500 cells is within expectations for a standard 10x run, median genes per cell >2,000 indicates decent capture quality, and 62.5% reads mapped to transcriptome is acceptable for a human sample.
- Workshop data should be organized under
${RCAC_SCRATCH}/scrna_workshop/with separate directories for FASTQ files, reference, and outputs - Cell Ranger count aligns 10x FASTQ files and produces a filtered count matrix, a web summary report, and alignment metrics
- STARsolo replicates Cell Ranger’s pipeline but runs approximately 9x faster and is fully open source
- Both tools produce a filtered count matrix in the same format: barcodes.tsv, features.tsv, and matrix.mtx
- Always inspect the Cell Ranger web_summary.html to check estimated cell count, median genes per cell, sequencing saturation, and fraction of reads in cells before proceeding